Prev. |  KEGG KO K01303 > 

RIKEN DNA Bank Human Resource - APEH

Gene ID NCBI Gene 327 |  KEGG hsa:327
Gene Symbol APEH
Protein Name acylaminoacyl-peptide hydrolase
Synonyms AARE|ACPH|APH|D3F15S2|D3S48E|DNF15S2|OPH
Ortholog resource in our bank

  APEH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080755 IRAL001O19 pOTB7 BC000362 NM_001640 Full
HGY080992 IRAL002H24 pOTB7 BC001499 NM_001640 Full
HGY084194 IRAL010I02 pOTB7 BC001826 NM_001640 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070169 ARe75H01 pKA1U5 NM_001640.3  
GGCCTCGCCCCGGCGGCAGAGAGGAGACTATGGAACGTCAGGTGCTGCTGAGCGAGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl