Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT2

Gene ID (NCBI) 318
Gene Symbol NUDT2
Protein Name nudix hydrolase 2
Synonyms APAH1
Databases KEGG hsa:318 |  NCBI Gene 318
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01518)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085346 IRAL013G02 pOTB7 BC004926 NM_147173 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235043 ARiS087K03 pGCAP10 NM_147173.1  
GGTCCNAGGTCCNCCTCCTACCTCCTTCTGCTTCGGTGCGTTTGCTTCTGAGGATCTCCA
HKR348836 RBb72B12 pGCAP1 NM_147173.1  
GGTACTTCAGTTTCCGTCCAAGGTCCGCCTCCTACCTCCTTCTGCTTCGGTGCGTTTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl