Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANXA11

Gene ID (NCBI) 311
Gene Symbol ANXA11
Protein Name annexin A11
Synonyms ANX11|CAP50
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17095)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY088875 IRAL022D03 pOTB7 BC007564 NM_145869 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037818 W01A094J02 pENTR-TOPO IRAL022D03 BC007564 NM_145869  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171202 ARi28A02 pGCAP10 NM_001157.2  
GGGAGTTTTCCGCCCGGCGCTGACGGCTGCTGCGCCCGCGGCTCCCCAGTGCCCCGAGTG
HKR062029 ARe55B05 pKA1U5 NM_001157.2  
GGCTCAGGCCCCGCCCCTCCCTTGCACATGCCATCCCCGTNNCNGGGGCAGCCGCGCCCG
HKR186922 ARi67F02 pGCAP10 NM_001157.2  
GGAGTTTTCCGCCCGGCGCTGACGGCTGCTGCGCCCGCGGCTCCCCAGTGCCCCGAGTGC
HKR072904 ARe82E08 pKA1U5 NM_001157.2  
GGCCCCTCCCTTGCACTGCCTCTGGCACCTGGGGCAGCCGCGCCCGCGGAGTTTTCCGCC
HKR075608 ARe89A08 pKA1U5 NM_001157.2  
GGGAGTTTTCCGCCCGGCGCTGACGGCTGCTGCGCCCGCGGCTCCCCAGNTGCCCCGAGT
HKR077727 ARe94F07 pKA1U5 NM_001157.2  
GGGCGCTGACNGNTGCTGCGCCCGCGGCTCCCCAGTTGCCCCGAGTGCCCCGCGGGCCCC
HKR209215 ARiS023A15 pGCAP10 NM_001157.2  
GAGGCCCCGCCCCTCCCTTGCACTGCCTCTGGCACCTGGGGCAGCCGCGCCCGCGGAGTT
HKR209398 ARiS023I06 pGCAP10 NM_001157.2  
GAGGCCCCGCCCCTCCCTTGCACTGCCTCTGGCACCTGGGGCAGCCGCGCCCGCGGAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl