Prev. |  KEGG KO K17095 > 

RIKEN DNA Bank Human Resource - ANXA7

Gene ID NCBI Gene 310 |  KEGG hsa:310
Gene Symbol ANXA7
Protein Name annexin A7
Synonyms ANX7|SNX|SYNEXIN
Ortholog resources KEGG ortholog (KEGG orthology K17095) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084821 IRAL012A21 pOTB7 BC002632 NM_001156 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062529 ARe56F09 pKA1U5 NM_001156.3  
GGGGCCCGCCCCCGGCTCCATCTTGCGGGAGACCNGTTTNGGGCTGTGACGCTGCTGCTG
HKR209428 ARiS023J12 pGCAP10 NM_001156.3  
GCCCCGGCTCCATCTTGCGGGAGACCGGGTTGGGCTGTGACGCTGCTGCTGGGGTCAGAA
HKR370525 RBd26F05 pGCAP10 NM_001156.3  
GGTGACGCTGCTGCTGGGGTCAGAATGTCATACCCAGGCTATCCCCCAACAGGCTACCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl