Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANXA7

Gene ID (NCBI) 310
Gene Symbol ANXA7
Protein Name annexin A7
Synonyms ANX7|SNX|SYNEXIN
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17095)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084821 IRAL012A21 pOTB7 BC002632 NM_001156 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062529 ARe56F09 pKA1U5 NM_001156.3  
GGGGCCCGCCCCCGGCTCCATCTTGCGGGAGACCNGTTTNGGGCTGTGACGCTGCTGCTG
HKR209428 ARiS023J12 pGCAP10 NM_001156.3  
GCCCCGGCTCCATCTTGCGGGAGACCGGGTTGGGCTGTGACGCTGCTGCTGGGGTCAGAA
HKR370525 RBd26F05 pGCAP10 NM_001156.3  
GGTGACGCTGCTGCTGGGGTCAGAATGTCATACCCAGGCTATCCCCCAACAGGCTACCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl