Prev. |  KEGG KO K17094 > 

RIKEN DNA Bank Human Resource - ANXA6

Gene ID NCBI Gene 309 |  KEGG hsa:309
Gene Symbol ANXA6
Protein Name annexin A6
Synonyms ANX6|CBP68|CPB-II|p68|p70
Ortholog resource in our bank

  ANXA6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080809 M01C002A09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE080857 M01C002C09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE080905 M01C002E09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE080953 M01C002G09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE081001 M01C002I09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE081049 M01C002K09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE081097 M01C002M09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  
HGE081145 M01C002O09 pDONR221 04-134-2_1-E05 BC017046 NM_001155  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062428 ARe56B04 pKA1U5 NM_001155.3  
GGCGGTTGCTGCTGGGCTAACGGGCTCCGATCCCCTTAGNGCTGCGTCCTCGAGTCCCTG
HKR238588 ARiS096H20 pGCAP10 NM_001155.3  
GCCGCCCCGCGCTGCGGTTGCTGCTGGGCTAACGGGCTCCGATCCAGCGAGCGCTGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl