Prev. |  KEGG KO K16646 > 

RIKEN DNA Bank Human Resource - ANXA5

Gene ID NCBI Gene 308 |  KEGG hsa:308
Gene Symbol ANXA5
Protein Name annexin A5
Synonyms ANX5|ENX2|HEL-S-7|PP4|RPRGL3
Ortholog resource in our bank

  ANXA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080828 IRAL002B04 pOTB7 BC012804 NM_001154 Full
HGY081960 IRAL004O24 pOTB7 BC001429 NM_001154 Full
HGY083872 IRAL009L08 pOTB7 BC004993 NM_001154 Full
HGY084261 IRAL010K21 pOTB7 BC012822 NM_001154 Full
HGY088854 IRAL022C06 pOTB7 BC012804 NM_001154 Full
HGY095218 IRAL038A18 pDNR-LIB BC018671 NM_001154 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044173 ARe10H05 pKA1U5 NM_001154.3  
GAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGCTCTGCATCTCGGCGTCGCCCCGCGNTA
HKR057729 ARe44F09 pKA1U5 NM_001154.3  
TGCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGT
HKR060057 ARe50C09 pKA1U5 NM_001154.3  
GAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACC
HKR078169 ARe95H01 pKA1U5 NM_001154.3  
ATCCTGGAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTAC
HKR160475 ARi01D03 pGCAP10 NM_001154.3  
GAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACC
HKR168857 ARi22C09 pGCAP10 NM_001154.3  
GAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCG
HKR175204 ARi38A04 pGCAP10 NM_001154.3  
TGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCC
HKR184102 ARi60E06 pGCAP10 NM_001154.3  
TGGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCG
HKR208239 ARiS020J23 pGCAP10 NM_001154.3  
TTGCTGGGATCAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGC
HKR234957 ARiS087G13 pGCAP10 NM_001154.3  
GAGTCTANGTGCAGCTGCCGGATCCTTCANCGTCTGCATCTCGGCGTCGCCCCGCGTACC
HKR243604 ARiS109A04 pGCAP10 NM_001154.3  
GAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCG
HKR276586 ARiS191H18 pGCAP10 NM_001154.3  
GAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGC
HKR366435 RBd16B11 pGCAP10 NM_001154.3  
CGGCCGGCCGATGAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl