Prev. |  KEGG KO K17093 > 

RIKEN DNA Bank Human Resource - ANXA4

Gene ID NCBI Gene 307 |  KEGG hsa:307
Gene Symbol ANXA4
Protein Name annexin A4
Synonyms ANX4|HEL-S-274|P32.5|PAP-II|PIG28|PP4-X|ZAP36
Ortholog resource in our bank

  ANXA4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053684 IRAK134D12 pCMV-SPORT6 BC063672 NM_001153 Full/var
HGY082657 IRAL006K17 pOTB7 BC000182 NM_001153 Full
HGY088327 IRAL020N15 pOTB7 BC011659 NM_001153 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348010 RBb70A10 pGCAP1 NM_001153.3  
GCGGATAAGACCCGCTGTCTGGCCCTGAGTAGGGTGTGACCTCCGCAGCCGCAGAGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl