Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANXA3

Gene ID (NCBI) 306
Gene Symbol ANXA3
Protein Name annexin A3
Synonyms ANX3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17089)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001718 IRAK004E22 pCMV-SPORT6 BC000871 NM_005139 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041746 ARe04G02 pKA1U5 NM_005139.2  
GACCCGGAGCCAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGCAGCTTTGT
HKR042084 ARe05D12 pKA1U5 NM_005139.2  
GAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGCAGTTTGTTCGCAGTTTAC
HKR043232 ARe08B08 pKA1U5 NM_005139.2  
GGCCTGCTGATACAGGGCATAGAGCCCGGCGGCAGCAGGGCGCGGCNTTCCCTTTCCCGG
HKR044508 ARe11E12 pKA1U5 NM_005139.2  
GGGACCCGGAGCCAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGCAGTTTG
HKR164010 ARi10A10 pGCAP10 NM_005139.2  
GGCAGGAGGAAGGGGTGCGGTCGCGATCCGGACCCGGAGCCAGCGCGGAGCACCTGCGCC
HKR165673 ARi14D01 pGCAP10 NM_005139.2  
GGGGGTGCGGTCGCGATCCGGACCCGGAGCCAGCGCGGAGCACCTGCGCCCGCGGCTGAC
HKR170005 ARi25A05 pGCAP10 NM_005139.2  
GGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGCAGTTTGTTCGCAGTTTACTCG
HKR170125 ARi25F05 pGCAP10 NM_005139.2  
GGGCTGACACCTTCGCTCGCAGTTTGTTCGCAGTTTACTCGCACACNNGTTTCCCCCACC
HKR054479 ARe36D07 pKA1U5 NM_005139.2  
GGGTTTGCTTCGCAGCNTTACTCGCACACCAGTTTTCCCCCACCGCGCTTTGGATTAGAT
HKR058148 ARe45G04 pKA1U5 NM_005139.2  
TGACCAGTTTCCCCCACCGCGCTTTGGATTAGCTGTGATCTCAGCTCAAGGCAAAGGTGG
HKR058152 ARe45G08 pKA1U5 NM_005139.2  
GGCGATCCGGACCCGGAGCCAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCG
HKR178905 ARi47E09 pGCAP10 NM_005139.2  
GCGATCCGGACCCGGAGCCAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGC
HKR182859 ARi57C11 pGCAP10 NM_005139.2  
GAGGAGGAAGGGGTGCGGTCGCGATCCGGACCCGGAGCCAGCGCGGAGCACCTGCGCCCG
HKR078027 ARe95B03 pKA1U5 NM_005139.2  
GGCAGTTTGTTCGCAGTTTACTCGCACACCAGNTTTCCCCCACCGCGCTTTGGATTAGTG
HKR218033 ARiS045B09 pGCAP10 NM_005139.2  
GAGTCGAGAGGCCGGAGGAGGGGCAGGAGGAAGGGGTGCGGTCGCGATCCGGACCCGGAG
HKR218220 ARiS045J04 pGCAP10 NM_005139.2  
GGCGGANCNCCTGCGCCCGCGGCTGACACCTTCGCTCGCAGTTTGTTCGCAGTTTACTCG
HKR247373 ARiS118H05 pGCAP10 NM_005139.2  
GCAGCGCGGAGCACCTGCGCCCGCGGCTGACACCTTCGCTCGCAGTTTGTTCGCAGTTTA
HKR260333 ARiS150N21 pGCAP10 NM_005139.2  
GAGGCCGGAGGAGGGGCANGANGAAGGGGTGCGGTCNCGATCCGGACCNGGANCCAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl