Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANXA2

Gene ID (NCBI) 302
Gene Symbol ANXA2
Protein Name annexin A2
Synonyms ANX2|ANX2L4|CAL1H|LIP2|LPC2|LPC2D|P36|PAP-IV
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17092)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005942 IRAK014O06 pCMV-SPORT6 BC009564 NM_004039 Full/var
HGY066954 IRAK167G10 pBluescriptR BC066955 NM_004039 Full
HGY095211 IRAL038A11 pDNR-LIB BC015834 NM_004039 Full
HGY081859 IRAL004K19 pOTB7 BC001388 NM_004039 Full
HGY092640 IRAL031J24 pDNR-LIB BC023990 NM_004039 Full/var
HGY092974 IRAL032H06 pDNR-LIB BC016774 NM_004039 Full
HGY096368 IRAL040P08 pOTB7 BC021114 NM_004039 Full
HGY098961 IRAL047G17 pOTB7 BC052558 NM_004039 Full
HGY099103 IRAL047M15 pOTB7 BC052567 NM_004039 Full
HGY101830 IRAL054J14 pOTB7 BC068065 NM_004039 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091248 M01C028B24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091296 M01C028D24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091344 M01C028F24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091392 M01C028H24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091440 M01C028J24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091488 M01C028L24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091536 M01C028N24 pDONR221 MGC03-H12 BC066955 NM_004039  
HGE091584 M01C028P24 pDONR221 MGC03-H12 BC066955 NM_004039  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042008 ARe05A08 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR042902 ARe07E06 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR082077 ARf05D05 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR082106 ARf05E10 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR082580 ARf06H12 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR161650 ARi04C02 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR162171 ARi05H03 pGCAP10 NM_004039.2  
GTCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR162507 ARi06E11 pGCAP10 NM_004039.2  
GGCTNAGCATTTGGGGACGCTTCTCAGCTTCTCGGCGCACGGCCCAGCTTCCTTCAAAAT
HKR163303 ARi08E07 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR045257 ARe13C09 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR046873 ARe17D01 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR165655 ARi14C07 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR166849 ARi17C01 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR166970 ARi17H02 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR167204 ARi18A04 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR048027 ARe20B03 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR049352 ARe23G08 pKA1U5 NM_004039.2  
GCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCNTTCCTTCAAAATGT
HKR050050 ARe25C02 pKA1U5 NM_004039.2  
GCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCATA
HKR168077 ARi20D05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR169205 ARi23A05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR169627 ARi24B03 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR171227 ARi28B03 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR052408 ARe31A08 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR052498 ARe31E02 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR054530 ARe36F10 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR054849 ARe37C01 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR172078 ARi30D06 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR172453 ARi31C05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR173260 ARi33C12 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR173674 ARi34D02 pGCAP10 NM_004039.2  
CGGCCGGCCGATGGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTT
HKR174127 ARi35F07 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR178010 ARi45A10 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR178011 ARi45A11 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR178408 ARi46A08 pGCAP10 NM_004039.2  
CGGCCGGCCGATGGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTT
HKR062403 ARe56A03 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGNCGCACNGNCCAGCTTCCTTCAAAATGT
HKR180123 ARi50F03 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR180829 ARi52B05 pGCAP10 NM_004039.2  
GTGGCTCAGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTC
HKR181611 ARi54A11 pGCAP10 NM_004039.2  
TGGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCNAATGT
HKR182011 ARi55A11 pGCAP10 NM_004039.2  
CGGCCGGCCGATGGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTT
HKR182828 ARi57B04 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR182884 ARi57D12 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR183747 ARi59G03 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR064012 ARe60A12 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGGNTGAAAATGTTTG
HKR064851 ARe62C03 pKA1U5 NM_004039.2  
GGAGCATTTGGGGGACGCTCTCAGCTCTCGGCGCACGGGCCCAGCTTCCTTCAAAATGTC
HKR065250 ARe63C02 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR065353 ARe63G09 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR066945 ARe67G01 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR067331 ARe68F11 pKA1U5 NM_004039.2  
GGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGTCTACTGTTCACGAAATC
HKR186033 ARi65B09 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR186549 ARi66G05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR186811 ARi67A11 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR187353 ARi68G09 pGCAP10 NM_004039.2  
AACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCC
HKR068027 ARe70B03 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR068977 ARe72H09 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR071602 ARe79A02 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR188049 ARi70C01 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR188555 ARi71G11 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAACTTCCTTCAAAATGT
HKR075345 ARe88G01 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR076001 ARe90A01 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR076426 ARe91B02 pKA1U5 NM_004039.2  
GGCTCACCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR077332 ARe93F12 pKA1U5 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR203429 ARiS008J13 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR203550 ARiS008O14 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR205373 ARiS013H05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR205408 ARiS013I16 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR208259 ARiS020K19 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR208321 ARiS020N09 pGCAP10 NM_004039.2  
GGCTCNNNATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR209218 ARiS023A18 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR209259 ARiS023C11 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR209461 ARiS023K21 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR219787 ARiS049H19 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR222077 ARiS055D05 pGCAP10 NM_004039.2  
GTGGCTGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGT
HKR234090 ARiS085D18 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR234213 ARiS085I21 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR235075 ARiS087L11 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGGTGAAAATGTTTGC
HKR235262 ARiS088C14 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR235545 ARiS088O09 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR238579 ARiS096H11 pGCAP10 NM_004039.2  
GGCTCANCATTTGGGGACGCTCTCNGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR243649 ARiS109C01 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR247225 ARiS118B01 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR247403 ARiS118I11 pGCAP10 NM_004039.2  
GGCTCANCNTTTGGGGACNCNCTCNGNTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR247430 ARiS118J14 pGCAP10 NM_004039.2  
TGGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCA
HKR248853 ARiS122C05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR264484 ARiS161D12 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR276416 ARiS191A16 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR276584 ARiS191H16 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR276714 ARiS191N02 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR276742 ARiS191O06 pGCAP10 NM_004039.2  
GGCTCANNATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR276761 ARiS191P01 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR277633 ARiS194B09 pGCAP10 NM_004039.2  
GGCTCAGCNTTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR277811 ARiS194I19 pGCAP10 NM_004039.2  
GGCTCANCNTTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCAT
HKR277902 ARiS194M14 pGCAP10 NM_004039.2  
GCCCACCCAGGCCAGCCGGCTCTGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCAC
HKR279415 ARiS198I23 pGCAP10 NM_004039.2  
HKR279493 ARiS198M05 pGCAP10 NM_004039.2  
GGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT
HKR279569 ARiS198P09 pGCAP10 NM_004039.2  
GGCTCAGCATTNGGGGNCNCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl