Prev. |  KEGG KO K17091 > 

RIKEN DNA Bank Human Resource - ANXA1

Gene ID NCBI Gene 301 |  KEGG hsa:301
Gene Symbol ANXA1
Protein Name annexin A1
Synonyms ANX1|LPC1
Ortholog resources KEGG ortholog (KEGG orthology K17091) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08927 pASK-IBA3plus-hANXA1 Expression clone of human ANXA1 in E. coli
RDB08928 C-Terminal p3xFLAG-CMV-hANXA1 Expression clone of human ANXA1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001762 IRAK004G18 pCMV-SPORT6 BC001275 NM_000700 Full
HGY096577 IRAL041H09 pDNR-LIB BC035993 NM_000700 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006105 W01A015E09 pENTR-TOPO IRAK004G18 BC001275 NM_000700  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054860 ARe37C12 pKA1U5 NM_000700.1  
TGAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGCTTCTTTGCAAGAAGGTAGAGATA
HKR064083 ARe60D11 pKA1U5 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR070907 ARe77E11 pKA1U5 NM_000700.1  
GGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCNTTNGTTTCTTTGCAAGAAGGTAGAGA
HKR077226 ARe93B02 pKA1U5 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR078031 ARe95B07 pKA1U5 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR082104 ARf05E08 pKA1U5 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR170903 ARi27E07 pGCAP10 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR182978 ARi57H10 pGCAP10 NM_000700.1  
GAGTGAGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAACAAGGTAGAGATCAA
HKR188521 ARi71F01 pGCAP10 NM_000700.1  
GATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTC
HKR235522 ARiS088N10 pGCAP10 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR264403 ARiS161A03 pGCAP10 NM_000700.1  
GAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAA
HKR276731 ARiS191N19 pGCAP10 NM_000700.1  
GCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl