Prev. |  KEGG KO K10380 > 

RIKEN DNA Bank Human Resource - ANK3

Gene ID NCBI Gene 288 |  KEGG hsa:288
Gene Symbol ANK3
Protein Name ankyrin 3
Synonyms ANKYRIN-G|MRT37
Ortholog resources KEGG ortholog (KEGG orthology K10380) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277743 ARiS194F23 pGCAP10 NM_020987.2  
TGGTCTGCCCCGCCCACCCTCCATTTAAATACTCTAGTTAGTTGCTTCTGACCAGCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl