Prev. |  KEGG KO K01490 > 

RIKEN DNA Bank Human Resource - AMPD2

Gene ID NCBI Gene 271 |  KEGG hsa:271
Gene Symbol AMPD2
Protein Name adenosine monophosphate deaminase 2
Synonyms PCH9|SPG63
Ortholog resource in our bank

  AMPD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086861 IRAL017C13 pOTB7 BC007711 NM_139156 Full
HGY103237 IRAL058B13 pOTB7 BC075844 NM_139156 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE105223 M01C063A23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105271 M01C063C23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105319 M01C063E23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105367 M01C063G23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105415 M01C063I23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105463 M01C063K23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105511 M01C063M23 pDONR221 06_06-A12 AK025706 NM_139156  
HGE105559 M01C063O23 pDONR221 06_06-A12 AK025706 NM_139156  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046853 ARe17C05 pKA1U5 NM_004037.6  
GGCTGGCCGGAGCTGCCTGCACTCTGCAGAGGCTCGGGGTGGTCTGGGGGCCCCTCCGCT
HKR238594 ARiS096I02 pGCAP10 NM_004037.6  
GGANANTTTGGTGNNNNNTCNNNNNNNNCGTGACNCCCCCACAGTNCCGGCCGCGGGGAN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl