Prev. |  KEGG KO K01611 > 

RIKEN DNA Bank Human Resource - AMD1

Gene ID NCBI Gene 262 |  KEGG hsa:262
Gene Symbol AMD1
Protein Name adenosylmethionine decarboxylase 1
Synonyms ADOMETDC|AMD|SAMDC
Ortholog resources KEGG ortholog (KEGG orthology K01611) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075300 ARe88E04 pKA1U5 NM_001634.4  
GGCTTACACAGNTATGGCCGGCGACATTAGCTAGCGCTCGCTCTACTCTCTCTAACGGGA
HKR395653 RBd89C05 pGCAP10 NM_001634.4 done
GGCTTACACAGTATGGCCGGCGACATTAGCTAGCGCTCGCTCTACTCTCTCTAACGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.13

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl