Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AKR1B1

Gene ID (NCBI) 231
Gene Symbol AKR1B1
Protein Name aldo-keto reductase family 1, member B1 (aldose reductase)
Synonyms ADR|ALDR1|ALR2|AR
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00011)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05832 pAxit-phAR-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05831 pAxit-phAR-rLuc (R) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05467 pKM2L-phAR Promoter Bank clone, Human aldose reductase promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082610 IRAL006I18 pOTB7 BC000260 NM_001628
HGY086514 IRAL016E18 pDNR-LIB BC005387 NM_001628 Full/var
HGY087652 IRAL019C04 pDNR-LIB BC010391 NM_001628 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042177 ARe05H09 pKA1U5 NM_001628.2  
GACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCCTGTTAAGCCGTCTCCTGCTCAACAACG
HKR162075 ARi05D03 pGCAP10 NM_001628.2  
TGGACCGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTC
HKR181732 ARi54F12 pGCAP10 NM_001628.2  
GACCGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTCAA
HKR208013 ARiS020A13 pGCAP10 NM_001628.2  
GGCCGACCTCACGGGCTATTTAAAGGTACGCGCCGCGGCCAAGGCCGCACCGTACTGGGC
HKR321306 RBb03E10 pKA1U5 NM_001628.2  
GGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTCAACAA
HKR365675 RBd14D03 pGCAP10 NM_001628.2  
GGCACCGTACTGGGC.GGGNTCT.GGNAGCGCAGCAGCCATGGC.ANCCGTCTCCTGCTC
HKR371284 RBd28D12 pGCAP10 NM_001628.2  
GACCGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTCAA
HKR395326 RBd88F06 pGCAP10 NM_001628.2  
GGGCGCCCTTTCTGCCGACCTCACGGGCTATTTAAAGGTACGCGCCGCGGCCAAGGCCGC
HKR428322 RBdS070N10 pGCAP10 NM_001628.2  
GGCACCGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTC
HKR433572 RBdS083P12 pGCAP10 NM_001628.2  
TGGCACCGTACTGGGCGGGGGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCT
HKR441779 RBdS104H11 pGCAP10 NM_001628.2  
GGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTCAACAACGGCGCCAAGATG
HKR441787 RBdS104H19 pGCAP10 NM_001628.2  
GGTCTGGGGAGCGCAGCAGCCATGGCAAGCCGTCTCCTGCTCAACAACGGCGCCAAGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl