Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALDH9A1

Gene ID (NCBI) 223
Gene Symbol ALDH9A1
Protein Name aldehyde dehydrogenase 9 family, member A1
Synonyms ALDH4|ALDH7|ALDH9|E3|TMABADH
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00149)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY067306 IRAK168E10 pBluescriptR BC070030 NM_000696 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080428 ARf01B04 pKA1U5 NM_000696.3  
GGCCACTCATGTTTCTCCGAGCAGGCCTGGCCGCGCTCTCCCCGCTTCTTCGCAGTCTTC
HKR046572 ARe16H04 pKA1U5 NM_000696.3  
GACTCATGTTTCTCCGAGCAGGCCTGGCCGCGCTCTCCCCGCTTCTTCGCAGTCTTCGGC
HKR180426 ARi51B02 pGCAP10 NM_000696.3  
GCCCGCGGCCCGTCAGCCTCTGCCGCGGAGCTGCGTCCGCCACTCATGTTTCTCCGAGCA
HKR430001 RBdS075A01 pGCAP10 NM_000696.3  
NNGCCNNNNGAATTTGAGTCTTCGGCCCTCTCCTGTCGCCGCCATGAGCACTGGCACCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl