Prev. |  KEGG KO K00149 > 

RIKEN DNA Bank Human Resource - ALDH9A1

Gene ID NCBI Gene 223 |  KEGG hsa:223
Gene Symbol ALDH9A1
Protein Name aldehyde dehydrogenase 9 family member A1
Synonyms ALDH4|ALDH7|ALDH9|E3|TMABADH
Ortholog resources KEGG ortholog (KEGG orthology K00149) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067306 IRAK168E10 pBluescriptR BC070030 NM_000696 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046572 ARe16H04 pKA1U5 NM_000696.3  
GACTCATGTTTCTCCGAGCAGGCCTGGCCGCGCTCTCCCCGCTTCTTCGCAGTCTTCGGC
HKR080428 ARf01B04 pKA1U5 NM_000696.3  
GGCCACTCATGTTTCTCCGAGCAGGCCTGGCCGCGCTCTCCCCGCTTCTTCGCAGTCTTC
HKR180426 ARi51B02 pGCAP10 NM_000696.3  
GCCCGCGGCCCGTCAGCCTCTGCCGCGGAGCTGCGTCCGCCACTCATGTTTCTCCGAGCA
HKR430001 RBdS075A01 pGCAP10 NM_000696.3  
NNGCCNNNNGAATTTGAGTCTTCGGCCCTCTCCTGTCGCCGCCATGAGCACTGGCACCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl