Prev. |  KEGG KO K00129 > 

RIKEN DNA Bank Human Resource - ALDH3B1

Gene ID NCBI Gene 221 |  KEGG hsa:221
Gene Symbol ALDH3B1
Protein Name aldehyde dehydrogenase 3 family member B1
Synonyms ALDH4|ALDH7
Ortholog resource in our bank

  ALDH3B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005651 IRAK014C03 pCMV-SPORT6 BC013584 NM_000694 Full
HGY092164 IRAL030G20 pOTB7 BC014168 NM_001030010 Partial
HGY097529 IRAL043N17 pOTB7 BC033099 NM_001030010 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235476 ARiS088L12 pGCAP10 NM_000694.2  
GCCCACCCCTCCCCCGGGGACTGGCCCTGCGTTGGACATTTCTTAACAGCAGGGCCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl