Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALDH1A3

Gene ID (NCBI) 220
Gene Symbol ALDH1A3
Protein Name aldehyde dehydrogenase 1 family, member A3
Synonyms ALDH1A6|ALDH6|MCOP8|RALDH3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00129)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY101796 IRAL054I04 pOTB7 BC069274 NM_000693 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080807 ARf02A07 pKA1U5 NM_000693.2  
GGAGCGGGCTGCGCAGTGTCCGGGCCGAGCCGGCTGCGCCGCAGACTAGGGCGCCTCGGG
HKR053211 ARe33A11 pKA1U5 NM_000693.2  
GAGTGTCCGGGCCGAGCCGGTGCGCCGCAGACTAGGGCGCCTCGGGCCAGGGAGCGCGGA
HKR058807 ARe47A07 pKA1U5 NM_000693.2  
GGGGCCGAGCCGGTGCGCCGCAGACTAGGGCGCCTCGGGCCAGGGAGCGCGGAGGAGCCA
HKR177779 ARi44H11 pGCAP10 NM_000693.2  
GAGCGGGCTGCGCAGTGTCCGGGCCGAGCCGGTGCGCCGCAGACTAGGGCGCCTCGGGCC
HKR073656 ARe84C08 pKA1U5 NM_000693.2  
GGGGAGCGGGCTGCGCAGTGTCCGGGCCGAGCCGGTGCGCCGCAGACTAGGGCGCCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl