Prev. |  KEGG KO K00128 > 

RIKEN DNA Bank Human Resource - ALDH1B1

Gene ID NCBI Gene 219 |  KEGG hsa:219
Gene Symbol ALDH1B1
Protein Name aldehyde dehydrogenase 1 family member B1
Synonyms ALDH5|ALDHX
Ortholog resource in our bank

  ALDH1B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082502 IRAL006E06 pOTB7 BC001619 NM_000692 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208203 ARiS020I11 pGCAP10 NM_000692.3  
CGGCCGGCCGATGACAGAGCTGGGAGGGCCGGAACCAGAACCCAAGCGTGATCCTGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl