Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AKT1

Gene ID (NCBI) 207
Gene Symbol AKT1
Protein Name v-akt murine thymoma viral oncogene homolog 1
Synonyms AKT|CWS6|PKB|PKB-ALPHA|PRKBA|RAC|RAC-ALPHA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Jak-STAT signaling pathwa (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04456)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06614 pFLAG-CMV-2-WT-human Akt1 Mammaian expression vector encoding human WT-Akt1
RDB07331 pGL4-phAKT1 Promoter collection, Human AKT1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX054171 IRAK135H03 pCMV-SPORT6 BC063408 NM_005163
HGY080765 IRAL001P05 pOTB7 BC000479 NM_005163 Full
HGY082525 IRAL006F05 pOTB7 BC001737 NM_005163 Partial
HGY103957 IRAL059O21 pOTB7 BC084538 NM_005163 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037629 W01A094B05 pENTR-TOPO IRAL001P05 BC000479 NM_005163  
HGE037643 W01A094B19 pENTR-TOPO IRAL001P05 BC000479 NM_005163  
HGE037960 W01A094O24 pENTR-TOPO IRAL001P05 BC000479 NM_005163  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361329 RBd03F09 pGCAP10 NM_005163.2  
GAGCGCGGCCCGAAGGACGGGAGCAGGCGGCCGAGCACCGAGCGCTGGGCACCGGGCACC
HKR335377 RBb38H09 pGCAP1 NM_005163.2  
AATGTGAGGACCGAGCGCGGCAGGCGGCTGGCCCAGCGCAGCCAGCGCGGCCCGAAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl