Prev. |  KEGG KO K00939 > 

RIKEN DNA Bank Human Resource - AK4

Gene ID NCBI Gene 205 |  KEGG hsa:205
Gene Symbol AK4
Protein Name adenylate kinase 4
Synonyms AK 4|AK3|AK3L1|AK3L2
Ortholog resources KEGG ortholog (KEGG orthology K00939) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020196 IRAK050I04 pCMV-SPORT6 BC040224 NM_203464 Full/var
HGY066901 IRAK167E05 pBluescriptR BC066944 NM_203464 Full/var
HGY091847 IRAL029K07 pOTB7 BC016180 NM_203464 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176497 ARi41E01 pGCAP10 NM_001005353.1  
GGCCTGGCCGCCCGGCCCCCTTCTCGGACGCGGCGTGGGGAGCGAGCTGGAGTTAAGGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl