Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AK2

Gene ID (NCBI) 204
Gene Symbol AK2
Protein Name adenylate kinase 2
Synonyms ADK2|AK 2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00939)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090775 IRAL026P15 pOTB7 BC009405 NM_001625 Full
HGY103070 IRAL057L06 pDNR-LIB BC070127 NM_001625 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062977 ARe57H09 pKA1U5 NM_001625.2  
GAGAGACTTCGGCGGACATGGCTCCCAGCGTGCCATCGGCAGAACCCGAGTATCCTAAAG
HKR185673 ARi64D01 pGCAP10 NM_001625.2  
HKR068971 ARe72H03 pKA1U5 NM_001625.2  
GGTGAGGCGTGCGAACTGGTGGCAGTGAGAGACTTCTGCGGACATGGCTCCCAGCGTGCC
HKR384858 RBd62C10 pGCAP10 NM_001625.2  
GGTTGACCTGGGAAGCACTGGACCTGTGAGGCGTGCGAACTGGTGGCAGTGAGAGACTTC
HKR395748 RBd89G04 pGCAP10 NM_001625.2  
GACTGGACCTGTGAGGCGTGCGAACTGGTGGCAGTGAGAGACTTCGGCGGACATGGCTCC
HKR397659 RBd94C11 pGCAP10 NM_001625.2  
GAGAGACTTCGGCGGACATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAG
HKR398057 RBd95C09 pGCAP10 NM_001625.2  
GACTGGACCTGTGAGGCGTGCGAACTGGTGGCAGTGAGAGACTTCGGCGGACATGGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl