Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AHCY

Gene ID (NCBI) 191
Gene Symbol AHCY
Protein Name adenosylhomocysteinase
Synonyms SAHH|adoHcyase
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01251)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081938 IRAL004O02 pOTB7 BC011606 NM_000687 Full
HGY090807 IRAL027A07 pOTB7 BC010018 NM_000687 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164855 ARi12C07 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR049629 ARe24B05 pKA1U5 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR186006 ARi65A06 pGCAP10 NM_000687.1  
GATCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTC
HKR074498 ARe86E02 pKA1U5 NM_000687.1  
ATCCTGTGCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCC
HKR203416 ARiS008I24 pGCAP10 NM_000687.1  
GCCCAGACTGAGGCCCAGCCCCCTTCGCCCGTTTCCATCACGAGTGCCGCCAGCATGTCT
HKR222026 ARiS055B02 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR222039 ARiS055B15 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR249062 ARiS122K22 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR249139 ARiS122O03 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR279423 ARiS198J07 pGCAP10 NM_000687.1  
TGATCCCNTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCT
HKR323632 RBb09B08 pKA1U5 NM_000687.1  
ATCCTGGCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGATTCCCAGACTGAGGCCCAGCCC
HKR362924 RBd07F04 pGCAP10 NM_000687.1  
GCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCCC
HKR367347 RBd18G03 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR378411 RBd46A11 pGCAP10 NM_000687.1  
GCTGCGAGCCGCAAACTGGCGGCGTGCTCCGCGGGAGAGCACACCTGGCCACGGCCTGGG
HKR379753 RBd49G09 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR341280 RBb53D08 pGCAP1 NM_000687.1  
GATCCCTGGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTT
HKR347605 RBb69A05 pGCAP1 NM_000687.1  
ATGCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR348449 RBb71C01 pGCAP1 NM_000687.1  
GGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCCCGT
HKR348579 RBb71H11 pGCAP1 NM_000687.1  
GATCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTC
HKR394178 RBd85H10 pGCAP10 NM_000687.1  
GCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCC
HKR405710 RBdS014E14 pGCAP10 NM_000687.1  
GCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCC
HKR406331 RBdS015N19 pGCAP10 NM_000687.1  
GCCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCG
HKR442118 RBdS105E22 pGCAP10 NM_000687.1  
GCCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGC
HKR444161 RBdS110G17 pGCAP10 NM_000687.1  
GCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCC
HKR475105 RBdS187M17 pGCAP10 NM_000687.1  
GCCTGCTCGGCGCTGCCCGCCCAGTTCCTGTTCCCAGACTGAGGCCCAGCCCCCTTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl