Prev. | 

RIKEN DNA Bank Human Resource - TLE5

Gene ID NCBI Gene 166 |  KEGG hsa:166
Gene Symbol TLE5
Protein Name TLE family member 5, transcriptional modulator
Synonyms AES|AES-1|AES-2|ESP1|GRG|GRG5|Grg-5
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222320 ARiS055N08 pGCAP10 NM_001130.5  
GACTGCCggCGTCgCCGCCaTTAgACAATAGCGGTGGGGCCGGgGAGCGGGGAGGCgGGC
HKR374505 RBd36E09 pGCAP10 NM_001130.5  
GGCGCGCCGGGGCCGGGCGCGCGGGGAGGGGGCGCAGGAAGCGGGCGAGGCCGGGCGCGG
HKR381677 RBd54D05 pGCAP10 NM_001130.5  
GATTAGACAATAGCGGTGGGGCCGGGGAGCGGGGAGGCGGGNNNCNNGGAGGGGCGGGGA
HKR390507 RBd76E11 pGCAP10 NM_001130.5  
GACTGCCGGCGTCGCCGCCATTAGACAATAGCGGTGGGGCCGGGGAGCGGGGAGGCGGGC
HKR396525 RBd91F05 pGCAP10 NM_001130.5  
GATTACACAATAGCGGTGGGGCCGGGGAGCGGGGAGGCGGGCGGCGGGGAGGGGCGGGGA
HKR396921 RBd92F01 pGCAP10 NM_001130.5  
GGCGGCAGGTGGAGCCGAAGCCTCCGCAGCAGCCGAGCCGCGGCCACTGCCGGCGTCGCC
HKR406276 RBdS015L12 pGCAP10 NM_001130.5  
GGGCGCGCGTCCCCCCCCTCNGNNGCNCNCACGGGGCACGGGCGGCGGCAGGTGGAGCCG
HKR430041 RBdS075B17 pGCAP10 NM_001130.5  
GAGCCGAGCCGCGGCCACTGCCGGCGTCGCCGCCATTAGACAATAGCGGTGGGGCCGGGG
HKR461856 RBdS154K16 pGCAP10 NM_001130.5  
GGCAGGAAGCGGGCGAGGCCGGGCGCGGGAGGCGGCGGCGGCCCCGGGAGCTGCCGATCG
HKR461869 RBdS154L05 pGCAP10 NM_001130.5  
GGGNCNNNNGGGGAGGGGGCGCAGGAAGCGGGCGAGGCCGGGCGCGGGAGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl