Prev. |  KEGG KO K11825 > 

RIKEN DNA Bank Human Resource - AP2B1

Gene ID NCBI Gene 163 |  KEGG hsa:163
Gene Symbol AP2B1
Protein Name adaptor related protein complex 2 subunit beta 1
Synonyms ADTB2|AP105B|AP2-BETA|CLAPB1
Featured content Endocytosis (human)
Featured content Huntington disease - human
Ortholog resource in our bank

  AP2B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084533 IRAL011F13 pOTB7 BC006201 NM_001282 Full/var
HGY091678 IRAL029D06 pOTB7 BC012150 NM_001030006 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024168 W01A060G24 pENTR-TOPO IRAL011F13 BC006201 NM_001282 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166176 ARi15H08 pGCAP10 NM_001282.2  
GGCCTTCGCCTCCGCCTCCGGTGCACATTAAAGATCCAAAGTCATGACTGACTCCAAGTA
HKR279478 ARiS198L14 pGCAP10 NM_001282.2  
GAGGGTGTGTCCCTAATTGACGGGGTCGGGGACGGAGAGAAGGGTAACACCAGGCTGGGT
HKR328002 RBb20A02 pKA1U5 NM_001282.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl