Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP2A2

Gene ID (NCBI) 161
Gene Symbol AP2A2
Protein Name adaptor-related protein complex 2, alpha 2 subunit
Synonyms ADTAB|CLAPA2|HIP-9|HIP9|HYPJ
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087379 IRAL018H11 pOTB7 BC006155 NM_012305 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085604 M01C014A04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085652 M01C014C04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085700 M01C014E04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085748 M01C014G04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085796 M01C014I04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085844 M01C014K04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085892 M01C014M04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  
HGE085940 M01C014O04 pDONR221 FLJ04-F02 AK075497 ENST00000329626  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081225 ARf03B01 pKA1U5 NM_012305.2  
TGAGAAAGCGGCGCTGGGACCCTGAGGCGGCCGTGGTTAGGCGGCTCCCCGGCGGCTCCT
HKR166430 ARi16B06 pGCAP10 NM_012305.2  
TGAGAAAGCGGCGCTGGGACCCTGAGGCGGCCGTGGTTAGGCGGCTCCCCGGCGGCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl