Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP2A1

Gene ID (NCBI) 160
Gene Symbol AP2A1
Protein Name adaptor-related protein complex 2, alpha 1 subunit
Synonyms ADTAA|AP2-ALPHA|CLAPA1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY092028 IRAL030B04 pOTB7 BC014214 NM_130787 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171755 ARi29G11 pGCAP10 NM_014203.2  
GAGCCCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTC
HKR059253 ARe48C05 pKA1U5 NM_014203.2  
GCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTCCCCG
HKR188154 ARi70G10 pGCAP10 NM_014203.2  
GGCCAGCCAGCCCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCG
HKR208293 ARiS020M05 pGCAP10 NM_014203.2  
GCCTCCCCNCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTCCCC
HKR330579 RBb26H11 pGCAP1 NM_014203.2  
CCGCTTGCCAGCCCCCGCTGCTCTGTGCCCTGTCCGGCCAGGCCTGGAGCCGACACCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl