Prev. |  KEGG KO K11824 > 

RIKEN DNA Bank Human Resource - AP2A1

Gene ID NCBI Gene 160 |  KEGG hsa:160
Gene Symbol AP2A1
Protein Name adaptor related protein complex 2 alpha 1 subunit
Synonyms ADTAA|AP2-ALPHA|CLAPA1
Ortholog resources KEGG ortholog (KEGG orthology K11824) in the DNA Bank
Featured content Endocytosis (human)
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092028 IRAL030B04 pOTB7 BC014214 NM_130787 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059253 ARe48C05 pKA1U5 NM_014203.2  
GCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTCCCCG
HKR171755 ARi29G11 pGCAP10 NM_014203.2  
GAGCCCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTC
HKR188154 ARi70G10 pGCAP10 NM_014203.2  
GGCCAGCCAGCCCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCG
HKR208293 ARiS020M05 pGCAP10 NM_014203.2  
GCCTCCCCNCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTCCCC
HKR330579 RBb26H11 pGCAP1 NM_014203.2  
CCGCTTGCCAGCCCCCGCTGCTCTGTGCCCTGTCCGGCCAGGCCTGGAGCCGACACCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl