Prev. |  KEGG KO K01756 > 

RIKEN DNA Bank Human Resource - ADSL

Gene ID NCBI Gene 158 |  KEGG hsa:158
Gene Symbol ADSL
Protein Name adenylosuccinate lyase
Synonyms AMPS|ASASE|ASL
Ortholog resources KEGG ortholog (KEGG orthology K01756) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082749 IRAL006O13 pOTB7 BC000253 NM_000026 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071655 ARe79C07 pKA1U5 NM_000026.2  
GCCCTGGTCCAGTCCACCCTGGCGGGGTCGCAGGGNTTGGGATGGCGGCTGGAGGCGATC
HKR171657 ARi29C09 pGCAP10 NM_000026.2  
GAGTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGGCTGGAGGCGATCATGGTTCGCC
HKR222263 ARiS055K23 pGCAP10 NM_000026.2  
GAGGTTTCCGCTTCCGCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGCAGGGTTGGG
HKR243719 ARiS109E23 pGCAP10 NM_000026.2  
TCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGGCTGGAGGCGA
HKR243721 ARiS109F01 pGCAP10 NM_000026.2  
GTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGGCTGGAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl