Prev. |  KEGG KO K05262 > 

RIKEN DNA Bank Human Resource - ADCYAP1

Gene ID NCBI Gene 116 |  KEGG hsa:116
Gene Symbol ADCYAP1
Protein Name adenylate cyclase activating polypeptide 1
Synonyms PACAP
Ortholog resources KEGG ortholog (KEGG orthology K05262) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078407 ARe96A07 pKA1U5 NM_001117.3  
GAGAAGGTGAGATTCGCGCGGCCTCGCGCACACCCGCGGCTGGGAGCTCGGGACTGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl