Prev. |  KEGG KO K08043 > 

RIKEN DNA Bank Human Resource - ADCY3

Gene ID NCBI Gene 109 |  KEGG hsa:109
Gene Symbol ADCY3
Protein Name adenylate cyclase 3
Synonyms AC-III|AC3|BMIQ19
Ortholog resources KEGG ortholog (KEGG orthology K08043) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367602 RBd19A02 pGCAP10 NM_004036.3  
GAGCGCGCGTGGCCCCGGAGCCGCCGGCGCCGCGCGGGGAATAGCTGTGCAGCACGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl