Prev. |  KEGG KO K01512 > 

RIKEN DNA Bank Human Resource - ACYP2

Gene ID NCBI Gene 98 |  KEGG hsa:98
Gene Symbol ACYP2
Protein Name acylphosphatase 2
Synonyms ACYM|ACYP
Ortholog resource in our bank

  ACYP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008634 IRAK021J18 pCMV-SPORT6 BC012290 NM_138448 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021001 W01A052I09 pENTR-TOPO IRAK021J18 BC012290 NM_138448  
HGE021003 W01A052I11 pENTR-TOPO IRAK021J18 BC012290 NM_138448  
HGE021007 W01A052I15 pENTR-TOPO IRAK021J18 BC012290 NM_138448  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181308 ARi53E12 pGCAP10 NM_138448.3  
GCTCTCGCAGCCGCCGCAGTCGCTGCGCCCCGAGCCCCTCTCCGGCTCCTCAACAGAGGG
HKR203213 ARiS008A13 pGCAP10 NM_138448.3  
GGACAGGCGCGGGGNGCGCCAAGCAGTCCCATGTGTCCCCTCCCTCTCGCAGCCGCCGCA
HKR234231 ARiS085J15 pGCAP10 NM_138448.3  
GCTCCCTCTCGCAGCCGCCGCAGTCGCTGCGCCCCGAGCCCCTCTCCGGCTCCTCAACAG
HKR264615 ARiS161I23 pGCAP10 NM_138448.3  
GGCGGAGCGACGGCGTCGGGGGAGGCGGTGGTGGCGGCAGCTGGAGCCCAACGGGCTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl