Prev. |  KEGG KO K14677 > 

RIKEN DNA Bank Human Resource - ACY1

Gene ID NCBI Gene 95 |  KEGG hsa:95
Gene Symbol ACY1
Protein Name aminoacylase 1
Synonyms ACY-1|ACY1D|HEL-S-5
Ortholog resources KEGG ortholog (KEGG orthology K14677) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082051 IRAL005C03 pOTB7 BC000545 NM_000666 Full
HGY083825 IRAL009J09 pOTB7 BC003023 NM_000666 Full
HGY092111 IRAL030E15 pOTB7 BC014112 NM_000666 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184434 ARi61B10 pGCAP10 NM_000666.1  
TGGGTCCTGAGCCTGCGACCTCGCAGGCGACCTCGCTGGACCCTAAGTCCAGGCCACAGT
HKR375772 RBd39H04 pGCAP10 NM_000666.1  
GACAGTCAGGGAAGGGCGCTGAGAGGCGAGCGTGAGCCCAGCGACAGGAGACTCACCACG
HKR378508 RBd46E12 pGCAP10 NM_000666.1  
GGACCTCGCTGGACCCTAAGTCCAGGCCACAGTCAGGGAAGGGCGCTGAGAGGCGAGCGT
HKR416255 RBdS040K15 pGCAP10 NM_000666.1  
GAAGTCCAGGCCACAGTCAGGGAAGGGCGCTGAGAGGCGAGCGTGAGCCCAGCGACAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl