DNA Bank Top |  KEGG KO K05699 > 

RIKEN DNA Bank Human Resource - ACTN1

Gene ID NCBI Gene 87 |  KEGG hsa:87
Gene Symbol ACTN1
Protein Name actinin alpha 1
Synonyms BDPLT15

Link

Ortholog resource in our bank

  ACTN1


External database

human ACTN1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18384 pET T7-7alpha-actinin1-SNAP-His Bacterial expression vector of human alpha actinin1 (ACTN1).    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083584 IRAL008P24 pOTB7 BC003576 NM_001102 Full
HGY093697 IRAL034E01 pOTB7 BC015766 NM_001102 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097624 M01C044A24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097672 M01C044C24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097720 M01C044E24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097768 M01C044G24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097816 M01C044I24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097864 M01C044K24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097912 M01C044M24 pDONR221 MGC11-F12 BC003576 NM_001102  
HGE097960 M01C044O24 pDONR221 MGC11-F12 BC003576 NM_001102  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045301 ARe13E05 pKA1U5 NM_001102.3  
GAGTGTGCGTGGAGATTAGGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAG
HKR054009 ARe35A09 pKA1U5 NM_001102.3  
GTTCGCCAGCAGCGCCGCGGCGGAACCGGGCGCAGGGGAGCGAGCCCGGCCCCGCCAGCC
HKR054904 ARe37E08 pKA1U5 NM_001102.3  
GAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCCAGNTAGCAGCCTTCGCCAGCAGCGCCG
HKR056884 ARe42D12 pKA1U5 NM_001102.3  
GAGGCAGTCCGCGTAGCCCAGACCGCCGCTGTCGCCGCCAGATAGCAGCCTTCGCCAGCA
HKR070059 ARe75C11 pKA1U5 NM_001102.3  
GGTGCGNTGGAGATTAGGTCCAAGCGCCCGCCCACANTTCAGGCAGTCCGCGAGCCCAGC
HKR070882 ARe77D10 pKA1U5 NM_001102.3  
GAGTTGTGCGCTGGTAGATTAGGTCCAAGCGCCCGCCCNTTAGGCAGGCAGTCCGCGAGC
HKR178880 ARi47D08 pGCAP10 NM_001102.3  
GGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCCAGTAGCAGC
HKR219681 ARiS049D09 pGCAP10 NM_001102.3  
GAGTGTGCGTGGAGATTANGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAG
HKR238530 ARiS096F10 pGCAP10 NM_001102.3  
GAGTCCNCNAGCCCAGCCGCCGCTGTCNCCGCCAGTAGCAGCCTTCGCCAGCAGCGCCGC
HKR238692 ARiS096M04 pGCAP10 NM_001102.3  
GAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCCAGTAGCAGCCTTCGCCAGCAGCGCCGC
HKR249173 ARiS122P13 pGCAP10 NM_001102.3  
AGGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAGCCGCCGCTGTCGCCGCC
HKR260241 ARiS150K01 pGCAP10 NM_001102.3  
GAGTGTGCGTGGAGATTANGTCCAAGCGCCCGCCCAGAGGCAGGCAGTCCGCGAGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl