Prev. |  KEGG KO K11340 > 

RIKEN DNA Bank Human Resource - ACTL6A

Gene ID NCBI Gene 86 |  KEGG hsa:86
Gene Symbol ACTL6A
Protein Name actin like 6A
Synonyms ACTL6|ARPN-BETA|Arp4|BAF53A|INO80K
Ortholog resources KEGG ortholog (KEGG orthology K11340) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013655 IRAK034C07 pBluescriptR BC036371 NM_178042 Full
HGY081893 IRAL004M05 pOTB7 BC001391 NM_178042 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007155 W01A017O19 pENTR-TOPO IRAL004M05 BC001391 NM_178042  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070929 ARe77F09 pKA1U5 NM_004301.3  
GGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTATCGCTCCTCGAGACTCGCAGTCGCG
HKR187756 ARi69G12 pGCAP10 NM_004301.3  
GGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTATCGCTCCTCGAGACTCGCAG
HKR205300 ARiS013E04 pGCAP10 NM_004301.3  
TGGTGTGGACGCCGCTTTGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGG
HKR218325 ARiS045N13 pGCAP10 NM_004301.3  
GGCTTTGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTATCGCTCCT
HKR243752 ARiS109G08 pGCAP10 NM_004301.3  
GGGGGTGTGTGGACGCCGCTTTGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTC
HKR248844 ARiS122B20 pGCAP10 NM_004301.3  
GGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTATCGCTCCTCGAGACTCGCAGTCGCG
HKR391227 RBd78B03 pGCAP10 NM_004301.3  
GGTGTGGACGCCGCTTTGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGG
HKR428102 RBdS070E06 pGCAP10 NM_004301.3  
GGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTATCGCTCCTCGAGA
HKR461635 RBdS154B11 pGCAP10 NM_004301.3  
GGGACGCCGCTTTGTTGCCTGAGGTGGGTGGCGGTGGAAGTTAAGGGAGTCAGGGGCTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl