Prev. |  KEGG KO K14394 > 

RIKEN DNA Bank Human Resource - ACP1

Gene ID NCBI Gene 52 |  KEGG hsa:52
Gene Symbol ACP1
Protein Name acid phosphatase 1
Synonyms HAAP|LMW-PTP|LMWPTP
Ortholog resource in our bank

  ACP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084072 IRAL010C24 pOTB7 BC007422 NM_007099 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024705 W01A061M17 pENTR-TOPO IRAL010C24 BC007422 NM_007099  
HGE024707 W01A061M19 pENTR-TOPO IRAL010C24 BC007422 NM_007099  
HGE024709 W01A061M21 pENTR-TOPO IRAL010C24 BC007422 NM_007099  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060483 ARe51D11 pKA1U5 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGNTCCGTGCTGTTTGTGTGTC
HKR205440 ARiS013J24 pGCAP10 NM_004300.3  
TTGCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR235092 ARiS087M04 pGCAP10 NM_004300.3  
GCTCGGCGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGT
HKR235268 ARiS088C20 pGCAP10 NM_004300.3  
GCTCGGCGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGT
HKR264654 ARiS161K14 pGCAP10 NM_004300.3  
GGCCTCNNCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR333633 RBb34B09 pGCAP1 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR340430 RBb51B06 pGCAP1 NM_004300.3  
GCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGG
HKR347706 RBb69E10 pGCAP1 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR369628 RBd24B04 pGCAP10 NM_004300.3  
GGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAA
HKR376428 RBd41B04 pGCAP10 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR386929 RBd67F09 pGCAP10 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR397730 RBd94F10 pGCAP10 NM_004300.3  
GGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAA
HKR433345 RBdS083G01 pGCAP10 NM_004300.3  
GGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl