Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACP1

Gene ID (NCBI) 52
Gene Symbol ACP1
Protein Name acid phosphatase 1, soluble
Synonyms HAAP
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084072 IRAL010C24 pOTB7 BC007422 NM_007099 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024705 W01A061M17 pENTR-TOPO IRAL010C24 BC007422 NM_007099  
HGE024707 W01A061M19 pENTR-TOPO IRAL010C24 BC007422 NM_007099  
HGE024709 W01A061M21 pENTR-TOPO IRAL010C24 BC007422 NM_007099  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060483 ARe51D11 pKA1U5 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGNTCCGTGCTGTTTGTGTGTC
HKR205440 ARiS013J24 pGCAP10 NM_004300.3  
TTGCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR235092 ARiS087M04 pGCAP10 NM_004300.3  
GCTCGGCGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGT
HKR235268 ARiS088C20 pGCAP10 NM_004300.3  
GCTCGGCGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGT
HKR264654 ARiS161K14 pGCAP10 NM_004300.3  
GGCCTCNNCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR369628 RBd24B04 pGCAP10 NM_004300.3  
GGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAA
HKR333633 RBb34B09 pGCAP1 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR376428 RBd41B04 pGCAP10 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR340430 RBb51B06 pGCAP1 NM_004300.3  
GCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGG
HKR347706 RBb69E10 pGCAP1 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR386929 RBd67F09 pGCAP10 NM_004300.3  
GGCCTCTGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCT
HKR397730 RBd94F10 pGCAP10 NM_004300.3  
GGCGCGCGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAA
HKR433345 RBdS083G01 pGCAP10 NM_004300.3  
GGGGAAGATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl