Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACADVL

Gene ID (NCBI) 37
Gene Symbol ACADVL
Protein Name acyl-CoA dehydrogenase, very long chain
Synonyms ACAD6|LCACD|VLCAD
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09479)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011253 IRAK028C05 pCMV-SPORT6 BC012912 NM_000018 Full
HGY080608 IRAL001I16 pOTB7 BC000399 NM_000018 Full
HGY096371 IRAL040P11 pOTB7 BC020218 NM_001033859 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099608 M01C049A08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099656 M01C049C08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099704 M01C049E08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099752 M01C049G08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099800 M01C049I08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099848 M01C049K08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099896 M01C049M08 pDONR221 MGC14-B04 BC000399 NM_000018  
HGE099944 M01C049O08 pDONR221 MGC14-B04 BC000399 NM_000018  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041485 W01A103L21 pENTR-TOPO IRAL001I16 BC000399 NM_000018  
HGE041487 W01A103L23 pENTR-TOPO IRAL001I16 BC000399 NM_000018  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082453 ARf06C05 pKA1U5 NM_000018.2  
GAGGACGTGGGCGTGCAGGACGCGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAG
HKR051678 ARe29D06 pKA1U5 NM_000018.2  
GGGGCGTGCAGGACGCGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAGCCAGCGG
HKR052027 ARe30B03 pKA1U5 NM_000018.2  
GAGAGCTGGGTCAGAGCTCGAGCCAGCGGCGCCCGGAGAGATTCGGAGATGCAGGCGGCT
HKR176177 ARi40H09 pGCAP10 NM_000018.2  
GGGTGCACTGTGGACGATGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGC
HKR181630 ARi54B06 pGCAP10 NM_000018.2  
GAGAGATTCGGAGATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAG
HKR067729 ARe69F09 pKA1U5 NM_000018.2  
ATCCTGGAGAGCTGGGTCAGAGCTCGAGCCAGCGNNGCCCGGAGAGATTCGGAGATGCAG
HKR372526 RBd31F06 pGCAP10 NM_000018.2  
GGCCAGGACGTGGGCGTGCAGGACGCGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTC
HKR340858 RBb52C10 pGCAP1 NM_000018.2  
GGCACTGTGGAACNATNTAGTCANGGNTTANGGGCGCCAGGNACCTGNNCGATGCAGGNA
HKR416239 RBdS040J23 pGCAP10 NM_000018.2  
CGGCCGGCCGATGGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl