Prev. |  KEGG KO K11262 > 

RIKEN DNA Bank Human Resource - ACACA

Gene ID NCBI Gene 31 |  KEGG hsa:31
Gene Symbol ACACA
Protein Name acetyl-CoA carboxylase alpha
Synonyms ACAC|ACACAD|ACC|ACC1|ACCA
Ortholog resource in our bank

  ACACA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005539 IRAK013O03 pCMV-SPORT6 BC031485 NM_198839 Partial
HGY097846 IRAL044K06 pOTB7 BC041598 NM_198839 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235456 ARiS088K16 pGCAP10 NM_198836.3 full cds  
GTCAGCCATCGCCCGAGCCGCCGGCGTCTCCTCCCGCCCAGCAGTTCCTCCACGCAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl