Prev. |  KEGG KO K07513 > 

RIKEN DNA Bank Human Resource - ACAA1

Gene ID NCBI Gene 30 |  KEGG hsa:30
Gene Symbol ACAA1
Protein Name acetyl-CoA acyltransferase 1
Synonyms ACAA|PTHIO|THIO
Ortholog resource in our bank

  ACAA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008503 IRAK021E07 pCMV-SPORT6 BC011977 NM_001607 Full
HGY082091 IRAL005D19 pOTB7 BC000635 NM_001607 Full
HGY093968 IRAL034P08 pOTB7 BC014474 NM_001607 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100807 M01C052A07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE100855 M01C052C07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE100903 M01C052E07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE100951 M01C052G07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE100999 M01C052I07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE101047 M01C052K07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE101095 M01C052M07 pDONR221 MGC15-E04 BC014474 ENST00000301810  
HGE101143 M01C052O07 pDONR221 MGC15-E04 BC014474 ENST00000301810  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175235 ARi38B11 pGCAP10 NM_001607.3  
GAACTCCGCGGTCAGTTCCCGGACTGGTGGCTGGTCTGCAGGGTTGACCTGCGCAATGCA
HKR186574 ARi66H06 pGCAP10 NM_001607.3  
GACGGGCGGCGCACGGCCATCTGCCGGGCGGGCCGCGGCGGCTTCAAGGTGAGGCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl