Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AANAT

Gene ID (NCBI) 15
Gene Symbol AANAT
Protein Name aralkylamine N-acetyltransferase
Synonyms DSPS|SNAT
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00669)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371602 RBd29A02 pGCAP10 NM_001088.2  
GGGGGGGAACATCTGCTACTACAGCCTTGCAGCCCGGAGTCCCGGATTTTACTGGTTCCC
HKR383206 RBd58A06 pGCAP10 NM_001088.2  
GACCACAGGCTGCCCGGGGAACATCTGCTACTACAGCCTTGCNNNNNGGAGTCCCGGATT
HKR416233 RBdS040J17 pGCAP10 NM_001088.2  
TGGGTGGGAGAGCTGACGTTTCCCTTCAGCAAGGCAGGGGCCGAGGCTGCCAGAGCCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl