Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AAMP

Gene ID (NCBI) 14
Gene Symbol AAMP
Protein Name angio-associated, migratory cell protein
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033941 IRAK084O05 pCMV-SPORT6 BC039866 NM_001087 Full
HGY086235 IRAL015J19 pOTB7 BC008809 NM_001087 Partial
HGY092167 IRAL030G23 pOTB7 BC014122 NM_001087 Full/var
HGY096031 IRAL040B07 pOTB7 BC020244 NM_001087 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085634 M01C014B10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085682 M01C014D10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085730 M01C014F10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085778 M01C014H10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085826 M01C014J10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085874 M01C014L10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085922 M01C014N10 pDONR221 FLJ04-H05 AK131047 NM_001087  
HGE085970 M01C014P10 pDONR221 FLJ04-H05 AK131047 NM_001087  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176029 ARi40B05 pGCAP10 NM_001087.3  
GGCTCGAGTTCCGCGTCGTCGCGCAGAGCTGACTCTGGGAGGCGTTTGGGCCCAGAGAAG
HKR178152 ARi45G08 pGCAP10 NM_001087.3  
GGCTCGAGTTCCGCGTCGTCGCGCAGAGCTGACTCTGGGAGGCGTTTGGGCCCAGAGAAG
HKR375207 RBd38A07 pGCAP10 NM_001087.3  
GGTTCCCTGACGCCTCCTCTGGCCCTTCCCCTCACACACCCCCTTCCCATCATCCCCTTG
HKR378180 RBd45H12 pGCAP10 NM_001087.3  
GAGAGAAGTGGATCCGCCGCTTGCGCCGCATGGAGTCCGAATCGGAAAGCGGGGCTGCTG
HKR388882 RBd72D10 pGCAP10 NM_001087.3  
GAGGGGCTCGAGTTCCGCGTCGTCGCGCAGAGCTGACTCTGGGAGGCGTTTGGGCCCAGA
HKR461645 RBdS154B21 pGCAP10 NM_001087.3  
GGCTCGAGTTCCGCGTCGTCGCGCAGAGCTGACTCTGGGAGGCGTTTGGGCCCAGAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl