Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Expression vector of sgRNA for left-target of mouse Dmd with hSpCas9-Cdt1(mouse) fusion protein.

Catalog number RDB16006
Resource name px330-mC-Dmd-L
Clone info. Expression vector of sgRNA for left-target of mouse Dmd (5'GGGAAACAAACTACTCATTG3') with hSpCas9-Cdt1(mouse) fusion protein.
Vector backbone pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid)
Size of vector backbone 8.5 kb
Selectable markers Ampicillin
Gene/insert name mouse Cdt1 cDNA mouse Dmd genomic S. pyogenes Cas9 3xFLAG,SV40NLS,nucleospolin NLS
Depositor|Developer Sugiyama, Fumihiro | Mizuno, Seiya |
Other clones in our bank mouse Cdt1 (NCBI Gene 67177) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature designated by the DEPOSITOR is requested (Mizuno-Iijima, S. et al., Methods 191: 23-31 (2021)).
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer Payment]
Exclusive MTA (For the DNA materials containing CRISPR/Cas9 technologies and for not-for-profit academic purpose) [Word]
The BIOLOGICAL RESOURCE is not provided to for-profit organization or for for-profit research by non-profit organizations. Please refer the Exclusive MTA (For the DNA materials containing CRISPR/Cas9 technologies and for not-for-profit academic purpose).
Distribution information (domestic users) [open/close]

Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB16006 px330-mC-Dmd-L Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


Original, user report and related articles
