Resource data sheet

B95. delta A delta fabR

Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon.

Catalog number RDB13712
Resource name B95. delta A delta fabR
Clone info. Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon. Spontaneous derivative of B95. delta A.
prfA gene has been deleted. Use primers prfAnoATG: AAGCCTTCTATCGTTGCCAAAC (22 bases) and prfATAARev: TTATTCCTGCTCGGACAACG (20 bases) for checking that the 1080 bp fragment of prfA gene is not amplified.
Depositor Sakamoto, Kensaku |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The materials are only available based on the written approval by the depositor. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature designated by the DEPOSITOR (Mukai, T., Sci. Rep. 5: 9699 2015.) and an acknowledgment to the DEPOSITOR are requested. The materials are only available for the user belonging to a nonprofit organization.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Approval form by depositor [Word]
Remarks ((Additional form)) Approval Form(FormD)
Derived from BL21(DE3).
Please obtain written approval of the depositor.
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB13712 B95. delta A delta fabR Bacteria in stub agar

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (English text)
Featured content Dnaconda's recommendation EXR0072e (English text)
Featured content Bacteria host strains (en) (English text)
Featured content Bacteria host strains (ja) (Japanese text)
Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (Japanese text)


original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.

User reports and related articles (go to bottom)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13712_A6Ehp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: B95.delta_fabR#1 ( templete 4 ) RDB13712_A6Ehc_templete4.seq
Primer: B95.delta_fabR#1 ( templete 7 ) RDB13712_A6Ehc_templete7.seq

Please visit Sequencing and PCR primers for primer information.



original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.
reference Mukai, T., Reassignment of a rare sense codon to a non-canonical amino acid in Escherichia coli. Nucleic Acids Res. 43 (16): 8111-8122 (2015). PMID 26240376.
