Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon.
Catalog number | RDB13712 |
---|---|
Resource name | B95. delta A delta fabR |
Clone info. | Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon. Spontaneous derivative of B95. delta A. prfA gene has been deleted. Use primers prfAnoATG: AAGCCTTCTATCGTTGCCAAAC (22 bases) and prfATAARev: TTATTCCTGCTCGGACAACG (20 bases) for checking that the 1080 bp fragment of prfA gene is not amplified. |
Growth remarks | It is recommended that colonies be isolated and cultured on an appropriate agar plate before performing your experiments. |
Depositor|Developer | Sakamoto, Kensaku | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR | The materials are only available based on the written approval by the depositor. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature designated by the DEPOSITOR (Mukai, T., Sci. Rep. 5: 9699 2015.) and an acknowledgment to the DEPOSITOR are requested. The materials are only available for the user belonging to a nonprofit organization. |
---|---|
Ordering | Please visit Information of Request for Distribution.[link] Order form [Credit Card Payment ![]() ![]() Material Transfer Agreement (MTA) [Word ![]() Approval form by depositor [Word ![]() |
Remarks | ((Additional form)) Approval Form(FormD) Derived from BL21(DE3). It is recommended that colonies be isolated and cultured on an appropriate agar plate before performing your experiments. Please obtain written approval of the depositor. |
Catalog # | Resource name | Shipping form | Fee (non-profit org.) |
---|---|---|---|
RDB13712 | B95. delta A delta fabR | Bacteria in stab agar |
Electronic file
Original reference
original | Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672. |
---|
Further references such as user reports and related articles (go to bottom)
Featured content
Featured content | Incorporation of synthetic amino acids into proteins at specific sites [link] (English text) |
---|---|
Featured content | Dnaconda's recommendation EXR0072e (English text) |
Featured content | Bacteria host strains (en) (English text) |
Featured content | Bacteria host strains (ja) (Japanese text) |
Featured content | Incorporation of synthetic amino acids into proteins at specific sites [link] (Japanese text) |
RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by icon as well as clone information before placing your order.
Test sheet | RDB17938_B0Cgp1-2.pdf ![]() |
---|
Nucleotide sequence of a portion of this resource (if available).
Please visit Sequencing and PCR primers for primer information.
Original, user report and related articles
original | Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672. |
---|---|
reference | Mukai, T., Reassignment of a rare sense codon to a non-canonical amino acid in Escherichia coli. Nucleic Acids Res. 43 (16): 8111-8122 (2015). PMID 26240376. |
user report | Zhu, P., A Highly Versatile Expression System for the Production of Multiply Phosphorylated Proteins. ACS Chem. Biol. 14 (7): 1564-1572 (2019). PMID 31243963. |
2020.10.02
GNP_filter3_RDBDEP_html_200316.pl