Resource data sheet

B95. delta A

Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon.

Catalog number RDB13711
Resource name B95. delta A
Clone info. Escherichia coli BL-21(DE3)-based host strain with no specific assignment of the UAG codon.
prfA gene has been deleted. Use primers prfAnoATG: AAGCCTTCTATCGTTGCCAAAC (22 bases) and prfATAARev: TTATTCCTGCTCGGACAACG (20 bases) for checking that the 1080 bp fragment of prfA gene is not amplified.
Vector backbone Bacteria culture
Depositor Sakamoto, Kensaku |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The materials are only available based on the written approval by the depositor. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature(s) designated by the DEPOSITOR is requested. (Mukai, T., Sci. Rep. 5: 9699 2015.) In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The materials are only available for the user belonging to a nonprofit organization.
(Japanese text [open/close])
Remarks ((Additional form)) Approval Form(FormD)
((Remarks)) Derived from BL21(DE3).
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB13711 B95. delta A Bacteria in stub agar

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13711_A6Ehp1_2.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: B95.delta_fabR#1 ( templete 5 ) RDB13711_A6Ehc_templete5.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Featured content

Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (English text)
Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (Japanese text)
Featured content Bacteria host strains (ja) (Japanese text)
Featured content Bacteria host strains (en) (English text)


original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.
reference Mukai, T., Reassignment of a rare sense codon to a non-canonical amino acid in Escherichia coli. Nucleic Acids Res. 43 (16): 8111-8122 (2015). PMID 26240376.
