Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

B95. delta A

Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon.

Catalog number RDB13711
Resource name B95. delta A
Clone info. Escherichia coli BL-21(DE3)-based host strain with no specific assignment of the UAG codon.
prfA gene has been deleted. Use primers prfAnoATG: AAGCCTTCTATCGTTGCCAAAC (22 bases) and prfATAARev: TTATTCCTGCTCGGACAACG (20 bases) for checking that the 1080 bp fragment of prfA gene is not amplified.
Growth remarks It is recommended that colonies be isolated and cultured on an appropriate agar plate before performing your experiments.
Depositor|Developer Sakamoto, Kensaku |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The materials are only available based on the written approval by the depositor. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature designated by the DEPOSITOR (Mukai, T., Sci. Rep. 5: 9699 2015.) and an acknowledgment to the DEPOSITOR are requested. The materials are only available for the user belonging to a nonprofit organization.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Approval form by depositor [Word]
Remarks ((Additional form)) Approval Form(FormD)
Derived from BL21(DE3). It is recommended that colonies be isolated and cultured on an appropriate agar plate before performing your experiments.
Please obtain written approval of the depositor.
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB13711 B95. delta A Bacteria in stab agar

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (English text)
Featured content Dnaconda's recommendation EXR0072e (English text)
Featured content Bacteria host strains (en) (English text)
Featured content Bacteria host strains (ja) (Japanese text)
Featured content Incorporation of synthetic amino acids into proteins at specific sites [link] (Japanese text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB17937_B0Cgp1-2.pdf check

Nucleotide sequence of a portion of this resource (if available).

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.
reference Hauf, M., Photoactivatable Mussel-Based Underwater Adhesive Proteins by an Expanded Genetic Code. Chembiochem. 18 (18): 1819-1823 (2017). PMID 28650092.
reference Mukai, T., Reassignment of a rare sense codon to a non-canonical amino acid in Escherichia coli. Nucleic Acids Res. 43 (16): 8111-8122 (2015). PMID 26240376.
protocol Seki, E., Cell-Free Protein Synthesis for Multiple Site-Specific Incorporation of Noncanonical Amino Acids Using Cell Extracts from RF-1 Deletion E. coli Strains. Methods Mol. Biol. 1728: 49-65 (2018). PMID 29404990.

2020.10.02

GNP_filter3_RDBDEP_html_200316.pl