Plasmid clone of Arabidopsis PIP2A water channel cDNA
| Catalog number | RDB07920 |
|---|---|
| Resource name | AtPIP2;1cDNA (-stop codon) |
| Clone info. | Plasmid clone of Arabidopsis PIP2A water channel cDNA. This clone does not include stop codon. Primers for PCR cloning: forward, 5' CACCATGGCAAAGGATGTGGAAG; reverse, 5' GACGTTGGCAGCACTTCT. |
| Vector backbone | pENTR/D-TOPO (Plasmid) |
| Selectable markers | Kan^r |
| Gene/insert name | Arabidopsis thaliana AtPIP2;1 cDNA |
| Depositor | Maeshima, Masayoshi | |
| Other clones in our bank | Arabidopsis thaliana PIP2A (KEGG orthology K09872) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
| Terms and conditions set forth by the DEPOSITOR | In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
|---|---|
| Ordering | Please visit Information of Request for Distribution. Order form [Credit Card Payment] [Bank Transfer or Check Payment] Material Transfer Agreement (MTA) [Word] |
| Remarks | Gateway® Entry clone. Please refer Life Technologies Corporation signs license agreement with RIKEN BRC. |
[open/close]| Catalog # | Resource name | Shipping form | Fee (non-profit org.) |
|---|---|---|---|
| RDB07920 | AtPIP2;1cDNA (-stop codon) | DNA solution |
Electronic file
Featured content
References
User reports and related articles (go to bottom)
This clone will be sequenced a portion and digested by restriction enzyme for examination.
References
2018.11.21
GNP_filter3_RDBDEP_html_181012.pl