Plasmid clone of Arabidopsis PIP2A water channel cDNA
Catalog number | RDB07920 |
---|---|
Resource name | AtPIP2;1cDNA (-stop codon) |
Clone info. | Plasmid clone of Arabidopsis PIP2A water channel cDNA. This clone does not include stop codon. Primers for PCR cloning: forward, 5' CACCATGGCAAAGGATGTGGAAG; reverse, 5' GACGTTGGCAGCACTTCT. |
Vector backbone | pENTR/D-TOPO (Plasmid) |
Selectable markers | Kan^r |
Gene/insert name | Arabidopsis thaliana AtPIP2;1 cDNA |
Depositor|Developer | Maeshima, Masayoshi | |
  | |
Other clones in our bank | Arabidopsis thaliana PIP2A (KEGG orthology K09872) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR | In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
---|---|
Ordering | Please visit Information of Request for Distribution.[link] Order form [Credit Card Payment ![]() ![]() Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word ![]() |
Remarks | Gateway® Entry clone. Please refer Life Technologies Corporation signs license agreement with RIKEN BRC. |
Catalog # | Resource name | Availability | Shipping form | Fee (non-profit org.) |
---|---|---|---|---|
RDB07920 | AtPIP2;1cDNA (-stop codon) | Under QC test. Please contact us. | DNA solution |
Electronic file
Original reference
Further references such as user reports and related articles (go to bottom)
Featured content
Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Original, user report and related articles
2021.03.25
GNP_filter3_RDBDEP_html_210308.pl