Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

AtPIP2;1cDNA (-stop codon)

Plasmid clone of Arabidopsis PIP2A water channel cDNA

Catalog number RDB07920
Resource name AtPIP2;1cDNA (-stop codon)
Clone info. Plasmid clone of Arabidopsis PIP2A water channel cDNA. This clone does not include stop codon.
Primers for PCR cloning: forward, 5' CACCATGGCAAAGGATGTGGAAG; reverse, 5' GACGTTGGCAGCACTTCT.
Vector backbone pENTR/D-TOPO (Plasmid)
Selectable markers Kan^r
Gene/insert name Arabidopsis thaliana AtPIP2;1 cDNA
Depositor|Developer Maeshima, Masayoshi |
 
Other clones in our bank Arabidopsis thaliana PIP2A (KEGG orthology K09872) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Remarks
Gateway® Entry clone. Please refer Life Technologies Corporation signs license agreement with RIKEN BRC.
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB07920 AtPIP2;1cDNA (-stop codon) Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2021.03.25

GNP_filter3_RDBDEP_html_210308.pl