Resource data sheet
Prev.

AtPIP1;1cDNA (-stop codon)

Plasmid clone of Arabidopsis PIP1A water channel cDNA

Catalog number RDB07919
Resource name AtPIP1;1cDNA (-stop codon)
Clone info. Plasmid clone of Arabidopsis PIP1A water channel cDNA. This clone does not include stop codon.
Primers for PCR cloning: forward, 5' CACCATGGAAGGCAAGGAAGAAG; reverse, 5' GCTTCTGGACTTGAAGGGG.
Vector backbone pENTR/D-TOPO (Plasmid)
Selectable markers Kan^r
Gene/insert name Arabidopsis thaliana AtPIP1;1 cDNA
Depositor Maeshima, Masayoshi |
 
Other clones in our bank Arabidopsis thaliana PIP1A (KEGG orthology K09872) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Remarks
Gateway® Entry clone. Please refer Life Technologies Corporation signs license agreement with RIKEN BRC.
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07919 AtPIP1;1cDNA (-stop codon) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl