Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGL4-phGLI1

Promoter collection, Human GLI1 promoter

Catalog number RDB07902
Resource name pGL4-phGLI1
Alternative name U3030-3
Clone info. PCR amplified human GLI1 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 57458742 to 57460211(NC_000012.12); relatively -1043 to +427, where +1 corresponds to 1 nt of NM_005269.3; corresponding to 1 to 51nt of NM_005269.2, 10 bp of intron and 1.4 kb up-stream; relatively -1396 to +74, where +1 corresponds to 1 nt of XM_011538190.2.
PCR cloning, forward primer: tgcccattagtctggtctga; reverse primer: cccttctcacctctgtctgg. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human GLI family zinc finger 1 genomic DNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human GLI1 (NCBI Gene 2735) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07902 pGL4-phGLI1 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07902_A7Jvp1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Sequence file: RDB07902_A7Jva.seq check
>07902_07902_A7Jv_pGL4-4174F_A03_01_ABI08.ab1
    1 GTGGGGTCAG ACTTTCTCTG GCCTACTGGC CGGTACCTGA GCTCGCTAGC CTCGAGGATT
   61 GCCCATTAGT CTGGTCTGAC TGAGCTGGGT CTCTGACCCT CTGGGGATAA CTAGCCTGGG
  121 TCAAAGTCCC AGATCTCCCC CTACCTTCAC CTTTTCTTTT CCCCCTTGAC CCTCAGACTG
  181 AACAGTTAAC CCACTGACCT TCCACACCCA AGGGGGTGGT TCTTGGAAGC AGAGCTAGGA
  241 TGTGGGAGGT CTGCCTGTGG GGTTGAAAAA AAGGGGAGAG GGTGCCCTTT TTCCTTGTCA
  301 TGCTTCCTCC TCTTTCTCAT AAAAATCAGA GACTGAAATG CTGCCCCTCC CTTATATCCG
  361 GTCACGATGG CAATGCAAAT CTAAAGAGGC AGGGCACTTC CCTGTCAGGC AGTACCGCTG
  421 GGCATAGCAA CCTCTGCCTC TCCGTTTCTC AGAGCTCACA TATCCACCTC CTGGGCTTTT
  481 AAGTGGGCTT TAGTGAGGGG CTCCTCCTTC AACTGGGCTC CTCCTTCAGT TCCCCAGCTC
  541 TTCTGCTTCG ACTCCGAGCG GGTGTCATGT GTGAGAACGG CCAGCAGAGG GAGCAGAAAG
  601 CCTGGAAGAG CAGCTAGAGC CTGCAGTGAC GTGGTGCGGA GGGGCGGCAC CCTCCAGAAC
  661 TTCGAGACGT AGAGCCGGGG TTCTAGGGAA AGGGGCTTCA GTCCCAGGGC TCCTTGGTGA
  721 CCTCGTGAAC CACACCCTGC ACCCAGAGCC TCAGCCGCTG CTCCTTGCTT TTATGCTCCA
  781 TAGACTCCTC ACCTTCTTCC AGAGCCCCCA ACCCAACTTG ATTTGCCCCA AACCGCAACT
  841 CTGTCCCGGC CGCTGCAAGT TCCATCCAAA GGGTGAGGCC TGCAGATAAA CCACAGGATG
  901 GCAGAATGCT CAGTTAGCAC CAACCAAAGG CGACTACCCT ACCTCCACTA TTATCGTTCT
  961 CGGTTGAACT TCTCCCCCCC TGCCCCGCAA TATTTTTCCC TCAATCTGGT TTGGTCGGGG
 1021 CCCTCTTTGG GGGCCAGCCG AATCCCAGAA AATCCAAGCC GGGATTTAGT TACTCACCAA
1081 TCAGCAGCCG ATGATTCAGG AACG
//
Primer: pGL4-136R
Sequence file: RDB07902_A7Jvb.seq check
>07902_07902_A7Jv_pGL4-136R_B03_02_ABI08.ab1
    1 GTTCTATAGG TTTTTGGGCA TCTTCCATGG TGGCTTTACC AACAGTACCG GATTGCCAAG
   61 CTTGGCCGCC GAGGCCAGAT CTTGATCCCT TCTCACCTCT GTCTGGGCGC TGGGCTCGGG
121 ATGCGCGGTC CAGGGCTGGA GTCTGGGCTG GGGGGTGTGC GGTGGGGAGG G
//
Primer: pAxCALNL_F1
Sequence file: RDB07902_A7Jvc.seq check
>07902_07902_A7Jv_pAxCALNL_F1_C03_03_ABI08.ab1
    1 TACAATGTAT CTTAATCATG TCTGCTCGAG CGGCCGGCCG CCCCGACTCT AGAATTATTA
   61 CACGGCGATC TTGCCGCCCT TCTTGGCCTT AATGAGAATC TCGCGGATCT TGCGGGCGTC
  121 CAACTTGCCG GTCAGTCCTT TAGGCACCTC GTCCACGAAC ACAACACCAC CGCGCAGCTT
  181 CTTGGCGGTT GTAACCTGGC TGGCCACATA GTCCACGATC TCCTTCTCGG TCATGGTTTT
  241 ACCGTGTTCC AGCACGACGA CTGCGGCGGG CAGCTCGCCG GCATCGTCGT CGGGCAGGCC
  301 GGCGACCCCG GCGTCGAAGA TGTTGGGGTG TTGCAGCAGG ATGCTCTCCA GTTCGGCTGG
  361 GGCTACCTGG TAGCCCTTGT ATTTGATCAG GCTCTTCAGC CGGTCCACGA TGAAGAAGTG
  421 CTCGTCCTCG TCCCAGTAGG CGATGTCGCC GCTGTGCAGC CAGCCGTCCT TGTCGATGAG
  481 AGCGTTTGTA GCCTCGGGGT TGTTAACGTA GCCGCTCATG ATCATGGGGC CACGGACGCA
  541 CAGCTCGCCG CGCTGGTTCA CACCCAGTGT CTTACCGGTG TCCAAGTCCA CCACCTTAGC
  601 CTCGAAGAAG GGCACCACCT TGCCTACTGC GCCAGGCTTG TCGTCCCCTT CGGGGGTGAT
  661 CAGAATGGCG CTGGTTGTTT CTGTCAGGCC GTAGCCCTGG CGGATGCCTG GTAGGTGGAA
  721 GCGTTTGGCC ACGGCCTCAC CTACCTCCTT GCTGAGCGGC GCCCCGCCGC TGGCGATCTC
  781 GTGCAAGTTG CTTAGGTCGT ACTTGTCGAT GAGAGTGCTC TTAGCGAAGA AGCTAAATAG
  841 TGTGGGCACC AGCAGGGGCA GATTGAATCT TATAGTCTTG CAAGCTGCGC AAGAATAGCT
  901 CCTCCTCGAA GCGGTACATG AGCACGACCC GAAAGCCGCA GATCAAGTAG CCCAGCGTGG
  961 TGAACATGCC GAAGCCGTGG TGAAAATGGC ACCACGCTGG AGGAATAGCG GTGTCGGGGG
 1021 ATGATCTGGT TGCCGAGATG GGGGTCGGCG GGGCCATGAA CTGAATCGGA CAACAAGGCG
1081 GAGGGCGGGT TGCCGGTA
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Patel, R., Novel GLI3 pathogenic variants in complex pre- and postaxial polysyndactyly and Greig cephalopolysyndactyly syndrome Am. J. Med. Genet. A 185 (1): 97-104 (2021). PMID 33058447.

2020.12.30

GNP_filter3_RDBDEP_html_201222.pl