Resource data sheet
Prev.

pGL4-phSMAD1(MADH1)

Promoter collection, Human SMAD1 promoter

Catalog number RDB07732
Resource name pGL4-phSMAD1(MADH1)
Alternative name U3031-22
Clone info. Promoter collection, Human SMAD1 promoter.
F-primer: tgcaaccatcaccagaaact; R-primer: gagcctggattgatctggtc.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human SMAD family member 1 genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human SMAD1 (NCBI Gene 4086) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07732 pGL4-phSMAD1(MADH1) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl