Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGL4-phCD55

Promoter collection, Human CR2 promoter.

Catalog number RDB07539
Resource name pGL4-phCD55
Alternative name U2886-2
Clone info. Pending.
PCR cloning, forward primer: AGGGGTGGTCCTAAGCTGGA; reverse primer: GGCCCTAGACTCGGGGAGAG. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human genomic DNA
Depositor|Developer DNA Bank, |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability
RDB07539 pGL4-phCD55 To be determined. Please contact us.

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07539.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.10.02

GNP_filter3_RDBDEP_html_200316.pl