Resource data sheet
Prev.

pGL4-phIL2RA

Promoter collection, Human IL2RA promoter

Catalog number RDB07525
Resource name pGL4-phIL2RA
Alternative name U2828-15
Clone info. Promoter collection. PCR amplified human IL2RA promoter sequence was inserted into a firefly luciferase vector.
F-primer: AAAGGAGCGTGACTTTGGTG; R-primer: TTGTGGGTCCATCCAGTCTC. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human interleukin 2 receptor, alpha genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human IL2RA (NCBI Gene 3559) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07525 pGL4-phIL2RA DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07525.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl