Resource data sheet
Prev.

pGL4-phEGFR

Promoter collection, Human EGFR promoter

Catalog number RDB07398
Resource name pGL4-phEGFR
Alternative name U2676(2054)-10
Clone info. Promoter collection. PCR amplified human EGFR promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (55,017,911 - 55,019,251nt of NC_000007.14) corresponding to 1 to 220nt of NM_005228.3 and 1.1 kb up-stream was cloned.
F-primer: AGCAAAGGGCAGGTCTGTAG; R-primer: GCTCTCCCGATCAATACTGG. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human EGFR (NCBI Gene 1956) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07398 pGL4-phEGFR DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07398.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07398_A6Ddp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F RDB07398_A6Dda.seq
>07398_07398_A6Dd_pGL4-4174F_A01_01.ab1
    1 AATGGGTCAG TACTTTCTCT GGCCTAACTG GCCGGTACCT GAGCTCGCTA GCCTCGAGGA
   61 TAGCAAAGGG CAGGTCTGTA GCTTCACTTA CTTCAGGATT GTGATTTTTG ACAGAGCCGA
  121 GAGATCAGGG TTGTTGAACC AGGCCTGAAG GTCCTAGTGA ATCTCGTGAA GAGAGGAGGG
  181 GTCTGGCTGT AACATGGACC TAGAGGACAT TTTTACTGCA GGAGAAGGAA CAGTGGGGAT
  241 GGGGTGGACT TGCCAAAGGA ATATAGCTCA AGTTCCTGCA GCCCAAAAAA GCTCAGTTTC
  301 TTTTGGCCAA AGCTTCCGCG AGTTTCCCTG GCATTTCTCC TGCGGGAGCT ACAGGGGCAG
  361 TGGGACACTT AGCCTCTCTA AAAGCACCTC CACGGCTGTT TGTGTCAAGC CTTTATTCCA
  421 AGAGCTTCAC TTTTGCGAAG TAATGTGCTT CACACATTGG CTTCAAAGTA CCCATGGCTG
  481 GTTGCAATAA ACATTAAGGA GGCCTGTCTC TGCACCCGGA GTTGGGTGCC CTCATTTCAG
  541 ATGATTTCGA GGGTGCTTGA CAAGATCTGA AGGACCCTCG GACTTTAGAG CACCACCTCG
  601 GACGCCTGGC ACCCCTGCCG CGCGGGCACG GCGACCTCCT CAGCTGCCAG GCCAGCCTCT
  661 GATCCCCGCG AGGGTCCCGT AGTGCTGCAG GGGAGGTGGG GACCCGAATA AAGGAGCAGT
  721 TTCCCCGTCG GTGCCATTAT CCGACGCTGG CTCTAAGGCT CGGCCAGTCT GTCTAAAGCT
  781 GGTACAAGTT TGCTTTGTAA AACAAAAGAA GGGAAAGGGG GAAGGGGACC CTGGCACAGA
  841 TTTGGCTCGA CCTGGACATA GGCTGGGCCT GCAAGTCCGC GGGGACCGGG TCCAGAGGGG
  901 CAGTGCTGGG AACGCCCCTC TCGGAAATTA ACTCCTCAGG GCACCCGCTC CCCTCCCATG
  961 CGCCGCCCCA CTCCCGCCGG GAGACTAGGT CCCGCGGGGG GCCCACCGCT GTCCACCGCC
 1021 CTCCGGCGGC CGGCTGGTCT TTGGTCCCCG CTGCTGATCC TCTCCCTTCT TCTTCGCAAT
1081 CTCCTCCTCC ATCTGCTTCC TTCCCGAATT CCATCCATCC CGACCGACCT TG
//
Primer: pGL4-136R RDB07398_A6Ddb.seq
>07398_07398_A6Dd_pGL4-136R_B01_04.ab1
    1 GCTATGTTTT TGGCATCTTC CATGGTGGCT TTACCAACAG TACCGGATTG CCAAGCTTGG
   61 CCGCCGAGGC CAGATCTTGA TGCTCTCCCG ATCAATACTG GACGGAGTCA GGGGGCCGTG
  121 CGCGGTGGTT GTGGCGTTGG CGGCGAGGCG GGGACTCGGG CGGACGCCGA CGAGGTGGCC
  181 TGTCGTCCGG TCTGGGCGGC GGCGGCCGCC GGGGCTAGCT CGGGACTCCG GCCGCCTCGG
  241 CCGCGGCGGG CGCTCACACC GTGCGGGGGG AGGAGGCTGC TGCGGCCGCG CTGCGCCGGG
  301 GGCTGCCCGG ACGTCTAGCT CGCGCGGGCC GAGGCGCGGG GAGGCAGGGC GGGAGGAGGA
  361 GGGACCAGGC GGCGGAGGAG GGATCGGGAG GAGCAGAGGA GGAGGAGAAT GCGAGGAGGA
  421 GGGAGGAGAA CCAGCAGCGG GGACCCAAGG CCAGCGGCCG CCGGAGGCGG TGGACAGCGG
  481 TGGCCCCCGC GGGACCTAGT CTCCGGCGGG AGTGGGGCGG CGCATGGGAG GGGAGCGGGT
  541 GCCCTGAGGA GTTAATTTCC GAGAGGGGCG TTCCCAGCAC TGCCCCTCTG GACCCGGTCC
  601 CCGCGGACTT GCAGGCCCAG CCTATGTCCA GGTCGAGCCA AATCTGTGCC AGGGTCCCCT
  661 TCCCCCTTTC CCTTCTTTTG TTTTACAAAG CAAACTTGTA CCAGCTTTAG ACAGACTGGC
  721 CGAGCCTTAG AGCCAGCGTC GGGATAATGG CACCGACGGG GAAACTGCTC CTTTATTCGG
  781 GGTCCCCACC TCCCCTGCAG CACTACGGGG ACCCTCGCGG GGGGATCAGA GGCTGGGCCT
  841 GGGCAGCTGG AGGAGGGTCG CCGTGCCCGC GCGGGCAGGG GGGTGCCAGG GCGGTCCGAG
  901 GGTGGTGGCT CTAAAGTTCC GAGGGGTCCT TCAGATCTTT GTCAAGCACC CCTCGAAATC
  961 ATCTGAAATG AGGGGCACCC CAACTCCGGG TTGCAAGACA GGGCCTTCCT TTTAATGTTA
 1021 TTTGCGACCC AGCCCATGGG GTTACTTTTG AAGCCAATGG TGTGGAAGCA CCATTACTTC
 1081 GCAAAAAGTG GAAGCTTCTT GGAAATAAAG GGCTTGACCC AACAGCCGTG AAGGTGCCTT
1141 TATGAAAG
//
Primer: pAxCALNL_F1 RDB07398_A6Ddc.seq
>07398_07398_A6Dd_pAxCALNL_F1_C01_07.ab1
    1 TCAAATCTTT CTTATCATGT CTGCTCGAAG CGGCCGGCCG CCCCGACTCT AGAATTATTA
   61 CACGGCGATC TTGCCGCCCT TCTTGGCCTT AATGAGAATC TCGCGGATCT TGCGGGCGTC
  121 CAACTTGCCG GTCAGTCCTT TAGGCACCTC GTCCACGAAC ACAACACCAC CGCGCAGCTT
  181 CTTGGCGGTT GTAACCTGGC TGGCCACATA GTCCACGATC TCCTTCTCGG TCATGGTTTT
  241 ACCGTGTTCC AGCACGACGA CTGCGGCGGG CAGCTCGCCG GCATCGTCGT CGGGCAGGCC
  301 GGCGACCCCG GCGTCGAAGA TGTTGGGGTG TTGCAGCAGG ATGCTCTCCA GTTCGGCTGG
  361 GGCTACCTGG TAGCCCTTGT ATTTGATCAG GCTCTTCAGC CGGTCCACGA TGAAGAAGTG
  421 CTCGTCCTCG TCCCAGTAGG CGATGTCGCC GCTGTGCAGC CAGCCGTCCT TGTCGATGAG
  481 AGCGTTTGTA GCCTCGGGGT TGTTAACGTA GCCGCTCATG ATCATGGGGC CACGGACGCA
  541 CAGCTCGCCG CGCTGGTTCA CACCCAGTGT CTTACCGGTG TCCAAGTCCA CCACCTTAGC
  601 CTCGAAGAAG GGCACCACCT TGCCTACTGC GCCAGGCTTG TCGTCCCCTT CGGGGGTGAT
  661 CAGAATGGCG CTGGTTGTTT CTGTCAGGCC GTAGCCCTGG CGGATGCCTG GTAGGTGGAA
  721 GCGTTTGGCC ACGGCCTCAC CTACCTCCTT GCTGAGCGGC GCCCCGCCGC TGGCGATCTC
  781 GTGCAAGTTG CTTAGGTCGT ACTTGTCGAT GAGAGTGCTC TTAGCGAAGA AGCTAAATAG
  841 TGTGGGCACC AGCAGGGCAG ATTGAATCTT ATAGTCTTGC AAGCTGCGCA AGAATAGCTC
  901 CTCCTCGAAG CGGTACATGA GCACGACCCG AAAGCCGCAG ATCAAGTAGC CCAGCGTGGT
  961 GAACATGCCG AAGCCCGTGG TGAAATGGGC ACCCACGCTG AGGATAGCGG TGTCGGGGGA
 1021 TGATCCTGGT TTGCCGAAGA TGGGGGTCGC GGGCCATGGA CTGAATCGGG ACACAGCAGT
1081 GCCGTTGCCG GTTAAGGACT TACGGCCCTT TTGGGTCAAT CCCGGATTAA CCTGC
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl