Resource data sheet
Prev.

pGL4-phTP53

Promoter collection, Human TP53 promoter

Catalog number RDB07330
Resource name pGL4-phTP53
Alternative name U2695(2073)-3
Clone info. Promoter collection. PCR amplified human TP53 promoter sequence was inserted into a firefly luciferase vector.
F-primer: GACAGCAGTCCGGAGCTAAC; R-primer: TAGCGCCAGTCTTGAGCAC. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human tumor protein p53 genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human TP53 (NCBI Gene 7157) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07330 pGL4-phTP53 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07330.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References

user report Shimizu, H., NF-kappaB plays an important role in indoxyl sulfate-induced cellular senescence, fibrotic gene expression, and inhibition of proliferation in proximal tubular cells. Am. J. Physiol. Cell Physiol. 301 (5): C1201-12 (2011). PMID 21832251.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl